A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(B3up) primer
Oligo ID:SG001005
Oligo type: Forward Primer Denegeracy: 1
Target: 48778-48801 Tm: 73.6C at salt 1000.0 mMLength: 24
Sequence: GTCTTGGCTGTAAATGTGATGTTC
(0 other experimental conditions)
Note: Contains two mismatches.

Experimental condition used for the oligonucleotide

Common Data ID: SG0010 Publication date: 2004
PMID: 14656465 GI: 2337967 Taxonomy ID:35252
Virus Name: Alcelaphine herpesvirus 1 Product size (PCR): 454 bp
MgCl2: 25 mM dNTPs: 0.1 mM Type: Nested PCR
Temp (PCR cycle):(94C 45sec>63C 45sec>72C 90sec)*25>(94C 45sec>63C 45sec>60sec)*30>72C 600sec
Buffer: 1x appropriate buffer (Sigma-Aldrich)
Polymerase: 1U Taq DNA poly (Sigma-Aldrich)Cycler: DNA Thermal Cycler (Perkin-Elmer Cetus)
Note: Contains two mismatches.

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.