A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(R1) primer
Oligo ID:SG000803
Oligo type: Reverse Primer Denegeracy: 1
Target: 28514-28495 Tm: 72C at salt 1000.0 mMLength: 20
Sequence: GGCTTAGCAGTGTCTCCATT
(0 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0008 Publication date: 2004
PMID: 12837557 GI: 9802268 Taxonomy ID:114429
Virus Name: Bovine adenovirus 2 Product size (PCR): 1670 bp
MgCl2: 25 mM dNTPs: 10 mM Type: PCR
Temp (PCR cycle):94C 120sec>(94C 30sec>55C 60sec>72C 60sec)*40>72C 600sec
Buffer: 4.4XPCR buffer (Promega)
Polymerase: 5U/microL Taq polyCycler: MJ Research Mini-Cycler(MJ Research, Inc)
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.