A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(NCCORP) primer
Oligo ID:SC000303
Oligo type: Hybridization Probe Denegeracy: 1
Target: 29075-29097 Tm: 76.8C at salt 1000.0 mMLength: 23
Sequence: CACGCATTGGCATGGAAGTCACA
(0 other experimental conditions)
Note: 6-carboxyfluorescein at 5' end and '6-carboxy tetramethylrhodamine at 3' end

Experimental condition used for the oligonucleotide

Common Data ID: SC0003 Publication date: 06/04
PMID: 15184466 GI: 30027617 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 69 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):61C 1200sec>95C 300sec>(95C 15sec>60C 30sec)*45
Buffer: LightCycler RNA Master Hybridization Probes kit (Roche)
Polymerase: Cycler: LightCycler RNA Master Hybridization Probes kit (Roche)
Note: 6-carboxyfluorescein at 5' end and '6-carboxy tetramethylrhodamine at 3' end

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.