A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(ARS4) primer
Oligo ID:SC000207
Oligo type: Forward Primer Denegeracy: 1
Target: 2348-2368 Tm: 74.4C at salt 1000.0 mMLength: 21
Sequence: ACCAACCTCCTTGATGTGGCT
(0 other experimental conditions)
Note: Two mismatches

Experimental condition used for the oligonucleotide

Common Data ID: SC0002 Publication date: 05/04
PMID: 15131187 GI: 15216732 Taxonomy ID:12118
Virus Name: Foot-and-mouth disease virus O Product size (PCR): 1,301 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):42C 30min>90C 5min>94C 3min>(94C 1min<55C 1 min<72C 1.5min)*40>72C 5min
Buffer: Ready-To-Go reverse transcription-PCR tube; Amersham Pharmacia Biotech
Polymerase: Cycler:
Note: Two mismatches

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.