A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(SARSF) primer
Oligo ID:SA000501
Oligo type: Forward Primer Denegeracy: 1
Target: 28538-28557 Tm: 70C at salt 1000.0 mMLength: 20
Sequence: TGAATACACCCAAAGACCAC
(1 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SA0005 Publication date: 12/03
PMID: 15070991 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 149 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.