A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(VARV) primer
Oligo ID:SA000101
Oligo type: Forward Primer Denegeracy: 1
Target: 7685-7710 Tm: 72.6C at salt 1000.0 mMLength: 26
Sequence: catccgatattattgtaaccacaatg
(0 other experimental conditions)
Note: 1150658

Experimental condition used for the oligonucleotide

Common Data ID: SA0001 Publication date: 2004
PMID: 15652214 GI: 9627521 Taxonomy ID:10255
Virus Name: Variola virus Product size (PCR): 203 bp
MgCl2: 2 mM dNTPs: 1 mM Type: Multiplex PCR
Temp (PCR cycle):93C 120sec>(93C 30sec>50C 45sec>72C 120sec)*30>72C 600sec
Buffer: 60mM Tris–HCl pH 8.5, 25mM KCl, 10mM 2-mercaptoethanol, 0.1% Triton X-100
Polymerase: Taq polyCycler: GeneAmp PCR System 9700
Note: 1150658

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.