A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(CR33) primer
Oligo ID:RH00021
Oligo type: PCR Denegeracy: 1
Target: 56378-56357 Tm: 82.2 C at salt 1000.0mMLength: 22
Sequence: GCTCCGGCGAGTAGCTGGTGTG
(1 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: RH0002 Publication date: 01/99
PMID: 10203465 GI: 2653291 Taxonomy ID:31518
Virus Name: Bovine herpesvirus type 1.1 (strain Jura); Bovine herpesvirus type 1.1 (strain Cooper); Bovine herpesvirus type 1.2 (strain K22); Caprine herpesvirus 1; Rangiferine herpesvirus 1; cervid herpesvirus 1; Bovine herpesvirus 5 (strain N569) Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: Nested PCR 2
Temp (PCR cycle):94C 9min>(95C 1min>62C 1min>72C min)*35>72C 7min
Buffer: 50mM KCl, 10mM Tris-HCl, 10% DMSO
Polymerase: 0.02U/microL Amplitaq Gold Poly (Perkin-Elmer Cetus)Cycler:
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.