A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(A) primer
Oligo ID:PN00431
Oligo type: Denegeracy: 1
Target: 1-30 Tm: 79.3 C at salt 1000.0mMLength: 30
Sequence: ATACATGTCATTTAAGACACCCACGCACCA
(1 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BH0066 Publication date: 07/94
PMID: 7933281 GI: 58575 Taxonomy ID:35252
Virus Name: Alcelaphine herpesvirus 1, AHV-1; Alcelaphine herpesvirus 2, AHV-2 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.25 mM Type: Universal PCR
Temp (PCR cycle):(94C 0.5min>50C 1min>70C 5min)*34>72C 10min
Buffer: 10mM Tris (pH 8.3), 50mM KCl, 100ng/microL gelatin
Polymerase: 0.02U/microL Taq DNA poly (Perkin-Elmer Cetus)Cycler:
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.