A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(PN00393) primer
Oligo ID:PN00393
Oligo type: Denegeracy: 1
Target: 10758-10779 Tm: 71 C at salt 1000.0mMLength: 22
Sequence: TGGAGATCTTTCACACAATAGC
(1 other experimental conditions)
Note: Mismatches at positions 10765, 10769, and 10774. BVDV1 specific, [GI:323205].

Experimental condition used for the oligonucleotide

Common Data ID: SK0102 Publication date: 06/99
PMID: 10325368 GI: 323205 Taxonomy ID:11099
Virus Name: pestivirus type 1, BVDV1; Bovine viral diarrhea virus genotype 2, BVDV2 Product size (PCR):
bp
MgCl2: 2.0 mM dNTPs: 0.2 mM Type: RT-Nested PCR
Temp (PCR cycle):(94C 20sec>50C 30sec>72C 30sec)*40>72C 15min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.025U/microL Taq DNA poly (Canadian Life Technologies)Cycler:
Note: Mismatches at positions 10765, 10769, and 10774. BVDV1 specific, [GI:323205].

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.