A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(BVD326) primer
Oligo ID:pn00292
Oligo type: Denegeracy: 1
Target: 395-375 Tm: 72.5 C at salt 1000.0mMLength: 21
Sequence: TCAACTCCATGTGCCATGTAC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SK0064 Publication date: 11/00
PMID: 11085469 GI: 7960753 Taxonomy ID:11100
Virus Name: bovine viral diarrhea virus (isolate NADL), NADL; pestivirus type 1 strain CS8644, CS8644 Product size (PCR):
bp
MgCl2: N/A mM dNTPs: 0.2 mM Type: Universal RT-PCR
Temp (PCR cycle):50C 45min>94C 2min>50C 4min>72C 5min>(94C 0.5min>50C 2min>72C 5min)*35>72C 15min
Buffer: 20mM Tris-HCl (pH 8.8), 10mM KCl, 10mM (NH4)2SO4, 2.0mM MgSO4, 0.1% Triton X-100, 10ng/microL BSA, 5mM DTT
Polymerase: 0.02U/microL AmpliTaq DNA poly (Perkin-Elmer Biosystems)Cycler: 2400, 9600 or 9700 thermocycler (Perkin-Elmer Biosystems)
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.