A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(PN00286) primer
Oligo ID:PN00286
Oligo type: Denegeracy: 1
Target: 395-375 Tm: 72.5 C at salt 1000.0mMLength: 21
Sequence: TCAACTCCATGTGCCATGTAC
(20 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SK0065 Publication date: 08/01
PMID: 11390104 GI: 9626649 Taxonomy ID:11099
Virus Name: Pestivirus type 1 Product size (PCR): 288 bp
MgCl2: N/A mM dNTPs: 0.3 mM Type: RT-PCR
Temp (PCR cycle):60C 30min>94C 1min>(94C 15sec>63C 40sec)*40>63C 7min
Buffer: 2.5mM Mn(OAc)2
Polymerase: 0.1U/microL rTth DNA poly (Perkin-Elmer)Cycler: GeneAmp PCR system 2400 (Perkin-Elmer)
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.