A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(BTKR1) primer
Oligo ID:pn00269
Oligo type: Denegeracy: 1
Target: 62987-62968 Tm: 72 C at salt 1000.0mMLength: 20
Sequence: GTCTTATCGTGGAGCTGAAG
(0 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SK0062 Publication date: 2000
PMID: 10971126 GI: 9629818 Taxonomy ID:10320
Virus Name: Bovine herpesvirus 1, BHV-1 Product size (PCR): 179 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: PCR
Temp (PCR cycle):97C 3min>61C 3min>72C 3min>(97C 1min>61C 1min>72C 1min)*20>(97C 30sec>61C 30sec>72C 30sec)*40
Buffer: 1x PCR buffer (Gibco BRL)
Polymerase: 0.025U/microL Taq DNA poly (Gibco BRL)Cycler: GeneAmp PCR System 2400 (Perkin-Elmer)
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.