A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(P2) primer
Oligo ID:pn00266
Oligo type: Denegeracy: 1
Target: 176-147 Tm: 75.2 C at salt 1000.0mMLength: 30
Sequence: ATCTTTCTTTCAGTCTCACTAAGTACACTA
(1 other experimental conditions)
Note: Multiple mismatches between position 157 and 147.

Experimental condition used for the oligonucleotide

Common Data ID: BM0993 Publication date: 11/00
PMID: 11110380 GI: 330689 Taxonomy ID:10385
Virus Name: Bovine herpesvirus 4, BHV-4 Product size (PCR): 153 bp
MgCl2: 2.0 mM dNTPs: 0.2 mM Type: Seminested PCR 1
Temp (PCR cycle):94C 1min>(94C 1min>59C 2min>72C 3min)*35
Buffer: 50mM KCl, 10mM Tris-HCl (pH 8.3)
Polymerase: 0.02U/microL Taq DNA poly (Perkin Elmer Corp.)Cycler:
Note: Multiple mismatches between position 157 and 147.



Oligonucleotide information
Reverse(P2) primer
Oligo ID:pn00266
Oligo type: Denegeracy: 1
Target: 176-147 Tm: 75.2 C at salt 1000.0mMLength: 30
Sequence: ATCTTTCTTTCAGTCTCACTAAGTACACTA
(1 other experimental conditions)
Note: Multiple mismatches between position 157 and 147.

Experimental condition used for the oligonucleotide

Common Data ID: BM0994 Publication date: 11/00
PMID: 11110380 GI: 330689 Taxonomy ID:10385
Virus Name: Bovine herpesvirus 4, BHV-4 Product size (PCR): 130 bp
MgCl2: 2.0 mM dNTPs: 0.2 mM Type: Seminested PCR 2
Temp (PCR cycle):94C 1min>(94C 1min>59C 2min>72C 3min)*35
Buffer: 50mM KCl, 10mM Tris-HCl (pH 8.3)
Polymerase: 0.02U/microL Taq DNA poly (Perkin Elmer Corp.)Cycler:
Note: Multiple mismatches between position 157 and 147.



Oligonucleotide information
Reverse(P2) primer
Oligo ID:pn00266
Oligo type: Denegeracy: 1
Target: 176-147 Tm: 75.2 C at salt 1000.0mMLength: 30
Sequence: ATCTTTCTTTCAGTCTCACTAAGTACACTA
(1 other experimental conditions)
Note: Multiple mismatches between position 157 and 147.

Experimental condition used for the oligonucleotide

Common Data ID: BM0993 Publication date: 11/00
PMID: 11110380 GI: 330689 Taxonomy ID:10385
Virus Name: Bovine herpesvirus 4, BHV-4 Product size (PCR): 153 bp
MgCl2: 2.0 mM dNTPs: 0.2 mM Type: Seminested PCR 1
Temp (PCR cycle):94C 1min>(94C 1min>59C 2min>72C 3min)*35
Buffer: 50mM KCl, 10mM Tris-HCl (pH 8.3)
Polymerase: 0.02U/microL Taq DNA poly (Perkin Elmer Corp.)Cycler:
Note: Multiple mismatches between position 157 and 147.



Oligonucleotide information
Reverse(P2) primer
Oligo ID:pn00266
Oligo type: Denegeracy: 1
Target: 176-147 Tm: 75.2 C at salt 1000.0mMLength: 30
Sequence: ATCTTTCTTTCAGTCTCACTAAGTACACTA
(1 other experimental conditions)
Note: Multiple mismatches between position 157 and 147.

Experimental condition used for the oligonucleotide

Common Data ID: BM0994 Publication date: 11/00
PMID: 11110380 GI: 330689 Taxonomy ID:10385
Virus Name: Bovine herpesvirus 4, BHV-4 Product size (PCR): 130 bp
MgCl2: 2.0 mM dNTPs: 0.2 mM Type: Seminested PCR 2
Temp (PCR cycle):94C 1min>(94C 1min>59C 2min>72C 3min)*35
Buffer: 50mM KCl, 10mM Tris-HCl (pH 8.3)
Polymerase: 0.02U/microL Taq DNA poly (Perkin Elmer Corp.)Cycler:
Note: Multiple mismatches between position 157 and 147.

Total 4 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.