A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(PN00089) primer
Oligo ID:PN00089
Oligo type: Denegeracy: 1
Target: 101-127 Tm: 80.5 C at salt 1000.0mMLength: 27
Sequence: TCGCCTCTTAGGGTGAAGACAGCTACT
(1 other experimental conditions)
Note: Used as probe for the Southern blot hybridization.

Experimental condition used for the oligonucleotide

Common Data ID: BH0004 Publication date: 10/94
PMID: 7858018 GI: 58575 Taxonomy ID:35252
Virus Name: Alcelaphine herpesvirus 1, AHV-1 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.8 mM Type: PCR
Temp (PCR cycle):(94C 1min>55C 1min>72C 3min)*35>72C 10min
Buffer: 10mM Tris (pH 8.3), 50mM KCl
Polymerase: 0.025U/microL Taq DNA poly (Perkin Elmer Cetus)Cycler:
Note: Used as probe for the Southern blot hybridization.

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.