A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(PN00065) primer
Oligo ID:PN00065
Oligo type: Denegeracy: 1
Target: 40349-40320 Tm: 75.2 C at salt 1000.0mMLength: 30
Sequence: GTACACGTCCTTATATCTGTTATAAGTAGT
(0 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BH0003 Publication date: 1990
PMID: 2241575 GI: 10140926 Taxonomy ID:35252
Virus Name: Alcelaphine herpesvirus 1, AHV-1 Product size (PCR): 1028 bp
MgCl2: 1.5 mM dNTPs: 1.25 mM Type: PCR
Temp (PCR cycle):(92C 1min>62C 1min>72C 2min)*30
Buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl
Polymerase: 0.5U Taq polyCycler:
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.