A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(SAmulti2-P-IR-292-269R) primer
Oligo ID:PM00593
Oligo type: Denegeracy: 1
Target: 932-909 Tm: 83.8 C at salt 1000.0mMLength: 24
Sequence: CCTCGGGGTACCTGAAGGGCATCC
(0 other experimental conditions)
Note: This is a TaqMan probe

Experimental condition used for the oligonucleotide

Common Data ID: MP0943 Publication date: 08/02
PMID: 12176143 GI: 12018088 Taxonomy ID:12110
Virus Name: Foot-and-mouth disease virus, FMDV Product size (PCR):
bp
MgCl2: N/A mM dNTPs: N/A mM Type: RT-PCR
Temp (PCR cycle):50C 2min>95C 10min>(95C 15sec>60C 60sec)*50
Buffer: N/A
Polymerase: N/ACycler: GeneAmp 5700 Sequence Detection System thermal cycler (Applied Biosystems)
Note: This is a TaqMan probe

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.