A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(BVDu3) primer
Oligo ID:PM00508
Oligo type: Denegeracy: 1
Target: 248-267 Tm: 70 C at salt 1000.0mMLength: 20
Sequence: CATGCCCAAAGCACATCTTA
(0 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0866 Publication date: 12/02
PMID: 12421586 GI: 7960753 Taxonomy ID:144353
Virus Name: Bovine viral diarrhea virus, BVDV Product size (PCR):
bp
MgCl2: 4 mM dNTPs: N/A mM Type: RT-PCR
Temp (PCR cycle):95C 30sec>(95C 1sec>55C 15sec>72C 15sec)*45
Buffer: N/A
Polymerase: 1x LightCycler RT-PCR Enzyme MixCycler: LightCycler (Roche Diagnostics)
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.