A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(PM00250) primer
Oligo ID:pm00250
Oligo type: Denegeracy: 1
Target: 6820-6839 Tm: 78.2 C at salt 1000.0mMLength: 20
Sequence: TCCTTTGCACGCCGTGGGAC
(0 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1829 Publication date: 06/02
PMID: 12051502 GI: 6456593 Taxonomy ID:12110
Virus Name: Foot-and-mouth disease virus, FMDV Product size (PCR):
bp
MgCl2: N/A mM dNTPs: 0.1 mM Type: RT-PCR
Temp (PCR cycle):60C 10min>(95C 2sec>60C 30sec)*45
Buffer: 5mM Mn(OAc)2, 1x EZ-RT-PCR buffer (Perkin Elmer), 0.2mM dUTP, 100ng/microL BSA, 500mM trehalose
Polymerase: 0.0001U/microL rTth DNA polyCycler: real-time SmartCycler (Cepheid Inc; Sunnyvale, CA)
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.