A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(Ol-Jas/Jf) primer
Oligo ID:pm00217
Oligo type: Denegeracy: 1
Target: 2175-2155 Tm: 72.5 C at salt 1000.0mMLength: 21
Sequence: CTGTGATCTTCTTACACACGG
(0 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1811 Publication date: 12/01
PMID: 11878878 GI: 2465191 Taxonomy ID:11099
Virus Name: pestivirus type 1 Product size (PCR):
bp
MgCl2: N/A mM dNTPs: 0.2 mM Type: RT-Nested PCR 2
Temp (PCR cycle):95C 2min>(95C 40sec>56C 40sec>72C 50sec)*30>72C 5min
Buffer: Taq polymerase buffer
Polymerase: Taq poly (QBiogene)Cycler:
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.