A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(Ol-B22.1R) primer
Oligo ID:pm00213
Oligo type: Denegeracy: 1
Target: 5227-5207 Tm: 70.5 C at salt 1000.0mMLength: 21
Sequence: GTTGACATGGCATTTTTCGTG
(4 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1807 Publication date: 12/01
PMID: 11878878 GI: 9836967 Taxonomy ID:11099
Virus Name: pestivirus type 1 Product size (PCR):
bp
MgCl2: 2.5 mM dNTPs: 0.45 mM Type: RT-Nested PCR 1(2)
Temp (PCR cycle):(94C 30sec>55C 30sec>72C 60sec)*35>68C 10min
Buffer: 25mM Tris-HCl (pH 8.3), 50mM KCl, 0.1% Triton X-100, 0.02% BSA
Polymerase: 0.1U/microL Taq poly (QBiogene)Cycler:
Note:



Oligonucleotide information
Reverse(Ol-B22.1R) primer
Oligo ID:pm00213
Oligo type: Denegeracy: 1
Target: 5227-5207 Tm: 70.5 C at salt 1000.0mMLength: 21
Sequence: GTTGACATGGCATTTTTCGTG
(4 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1809 Publication date: 12/01
PMID: 11878878 GI: 9836967 Taxonomy ID:11099
Virus Name: pestivirus type 1 Product size (PCR):
bp
MgCl2: N/A mM dNTPs: N/A mM Type: RT-Nested PCR 1(4)
Temp (PCR cycle):(94C 30sec>52C 30sec>68C 90sec)*9>(94C 30sec>52C 30sec>68C 45sec[+5sec/cyc])*25>68C 7min
Buffer: N/A
Polymerase: N/ACycler:
Note:



Oligonucleotide information
Reverse(Ol-B22.1R) primer
Oligo ID:PM00213
Oligo type: Denegeracy: 1
Target: 5227-5207 Tm: 70.5 C at salt 1000.0mMLength: 21
Sequence: GTTGACATGGCATTTTTCGTG
(4 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1807 Publication date: 12/01
PMID: 11878878 GI: 9836967 Taxonomy ID:11099
Virus Name: pestivirus type 1 Product size (PCR):
bp
MgCl2: 2.5 mM dNTPs: 0.45 mM Type: RT-Nested PCR 1(2)
Temp (PCR cycle):(94C 30sec>55C 30sec>72C 60sec)*35>68C 10min
Buffer: 25mM Tris-HCl (pH 8.3), 50mM KCl, 0.1% Triton X-100, 0.02% BSA
Polymerase: 0.1U/microL Taq poly (QBiogene)Cycler:
Note:



Oligonucleotide information
Reverse(Ol-B22.1R) primer
Oligo ID:PM00213
Oligo type: Denegeracy: 1
Target: 5227-5207 Tm: 70.5 C at salt 1000.0mMLength: 21
Sequence: GTTGACATGGCATTTTTCGTG
(4 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1809 Publication date: 12/01
PMID: 11878878 GI: 9836967 Taxonomy ID:11099
Virus Name: pestivirus type 1 Product size (PCR):
bp
MgCl2: N/A mM dNTPs: N/A mM Type: RT-Nested PCR 1(4)
Temp (PCR cycle):(94C 30sec>52C 30sec>68C 90sec)*9>(94C 30sec>52C 30sec>68C 45sec[+5sec/cyc])*25>68C 7min
Buffer: N/A
Polymerase: N/ACycler:
Note:

Total 4 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.