A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(PL000900) primer
Oligo ID:PL00090
Oligo type: Denegeracy: 1
Target: 6361-6380 Tm: 76.1 C at salt 1000.0mMLength: 20
Sequence: TTGCACCCACCGTTGCACAC
(0 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0306 Publication date: 08/95
PMID: 8530568 GI: 61076 Taxonomy ID:73482
Virus Name: Foot-and-mouth disease virus (strain O1Campos), FMDV Product size (PCR): N/A bp
MgCl2: 0.5 mM dNTPs: N/A mM Type: RT-PCR
Temp (PCR cycle):(94C 45sec>54C 45sec>72C 90sec)*30>72C 7min
Buffer: PCR buffer(33.33mM KCl, 33.33mM Tris HCl, pH 8.3)
Polymerase: 0.0833U/microL Taq polyCycler: Thermocycler (Perkin Elmer Cestus)
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.