A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(P2) primer
Oligo ID:pj00363
Oligo type: Denegeracy: 1
Target: 3378-3358 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0546 Publication date: 1993
PMID: 8385843 GI: 61076 Taxonomy ID:12115
Virus Name: Foot-and-mouth disease virus (strain A24 Cruzeiro); Foot-and-mouth disease virus Asia 1; foot-and-mouth disease virus C1; Foot-and-mouth disease virus O; Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 5min>(94C 1min>50C 1min>70C 2min)*30>70C 7min
Buffer: 66mM Tris-HCl (pH 8.3), 17mM (NH4)2SO4, 850microg/mL BSA, 10mM 2-mercaptoethanol
Polymerase: 1.25U Taq poly (AmpliTaq, Perkin-Elmer Cetus)Cycler: thermal cycler (Perkin-Elmer Cetus)
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.