A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(TK2) primer
Oligo ID:pj00351
Oligo type: Denegeracy: 1
Target: 64178-64159 Tm: 76.1 C at salt 1000.0mMLength: 20
Sequence: ACACGTCCAGCACGAACACC
(2 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0537 Publication date: 10/01
PMID: 11708680 GI: 9629818 Taxonomy ID:10320
Virus Name: Bovine herpesvirus 1, BHV-1; Bovine herpesvirus 5, BHV-5 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.1 mM Type: multiplex PCR
Temp (PCR cycle):95C 1min>(95C 1min>61.4C 1min>72C 1min)*35>72C 5min
Buffer: 1x Taq polymerase buffer, 5microL glycerol
Polymerase: 0.05U/microL Taq polyCycler:
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.