A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(P1) primer
Oligo ID:pj00344
Oligo type: Denegeracy: 1
Target: 3923-3903 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Mismatch at position 3914.

Experimental condition used for the oligonucleotide

Common Data ID: BM0536 Publication date: 03/98
PMID: 9629589 GI: 12018088 Taxonomy ID:12111
Virus Name: Foot-and-mouth disease virus A; Foot-and-mouth disease virus C; Foot-and-mouth disease virus O; Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: N/A mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):96C 60sec>(96C 12sec>49C 20sec>70C 40sec)*30
Buffer: 1x buffer (DynaZyme)
Polymerase: 0.02U/microL Taq poly (DynaZyme)Cycler:
Note: Mismatch at position 3914.

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.