A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(PJ00341) primer
Oligo ID:pj00341
Oligo type: Denegeracy: 1
Target: 3759-3740 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0535 Publication date: 05/99
PMID: 10328832 GI: 15320904 Taxonomy ID:12115
Virus Name: Foot-and-mouth disease virus (strain A24 Cruzeiro) Product size (PCR):
bp
MgCl2: 4.6 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):(95C 10sec>60C 10sec)*5>(95C 0sec>60C 0sec>72C 5sec)*25
Buffer: 0.8x Stoffel buffer (Perkin-Elmer)
Polymerase: 0.5microL Stoffel fragment of Taq DNA poly (Perkin-Elmer)Cycler: Perkin-Elmer 9600
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.