A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(PJ00327) primer
Oligo ID:pj00327
Oligo type: Denegeracy: 1
Target: 3194-3213 Tm: 70 C at salt 1000.0mMLength: 20
Sequence: ACGCTAGACAACAAACTACG
(0 other experimental conditions)
Note: Mismatch at position 3202.

Experimental condition used for the oligonucleotide

Common Data ID: BM0489 Publication date: 06/94
PMID: 8079512 GI: 10445391 Taxonomy ID:12120
Virus Name: Foot-and-mouth disease virus (strain C1-Santa Pau) Product size (PCR):
bp
MgCl2: 1.6 mM dNTPs: 0.04 mM Type: RT-PCR
Temp (PCR cycle):(94C 1min>55C 1min>72C 2min)*30>72C 8min
Buffer: 10mM Tris-HCl (pH 8.3), 4.0mM KCl
Polymerase: 0.025U/microL Taq poly (Promega)Cycler: DNA thermal cycler (Perkin Elmer)
Note: Mismatch at position 3202.

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.