A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(1P) primer
Oligo ID:pj00323
Oligo type: Denegeracy: 1
Target: 579-600 Tm: 80.3 C at salt 1000.0mMLength: 22
Sequence: TTCGAGAACGGCACGGTCGGAC
(0 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0492 Publication date: Fall/91
PMID: 1666635 GI: 210476 Taxonomy ID:73482
Virus Name: Foot-and-mouth disease virus (strain O1); foot-and-mouth disease virus C1; Foot-and-mouth disease virus (strain A12); Foot-and-mouth disease virus (strain A5); Foot-and-mouth disease virus Asia 1 Product size (PCR):
bp
MgCl2:
mM
dNTPs:
mM
Type: Southern blot hybridization
Temp (PCR cycle):42C 12hr
Buffer: 5x SSC, 0.04% SDS, 0.1% N-lauroylsarcosine, 2% modified milk protein (Boehringer-Manheim)
Polymerase:
Cycler:
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.