A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(1DS) primer
Oligo ID:pj00322
Oligo type: Denegeracy: 1
Target: 838-819 Tm: 78.2 C at salt 1000.0mMLength: 20
Sequence: TCAGGGTTGCAACCGACCGC
(0 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0490 Publication date: Fall/91
PMID: 1666635 GI: 210476 Taxonomy ID:73482
Virus Name: Foot-and-mouth disease virus (strain O1); foot-and-mouth disease virus C1; Foot-and-mouth disease virus (strain A12); Foot-and-mouth disease virus (strain A5); Foot-and-mouth disease virus Asia 1 Product size (PCR): 454 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR 1
Temp (PCR cycle):(95C 30sec>55C 30sec>72C 30sec)*30
Buffer: 1x PCR buffer
Polymerase: 0.005U/microL Taq DNA poly (Perkin-Elmer Cetus)Cycler:
Note:



Oligonucleotide information
Reverse(1DS) primer
Oligo ID:pj00322
Oligo type: Denegeracy: 1
Target: 838-819 Tm: 78.2 C at salt 1000.0mMLength: 20
Sequence: TCAGGGTTGCAACCGACCGC
(0 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0490 Publication date: Fall/91
PMID: 1666635 GI: 210476 Taxonomy ID:73482
Virus Name: Foot-and-mouth disease virus (strain O1); foot-and-mouth disease virus C1; Foot-and-mouth disease virus (strain A12); Foot-and-mouth disease virus (strain A5); Foot-and-mouth disease virus Asia 1 Product size (PCR): 454 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR 1
Temp (PCR cycle):(95C 30sec>55C 30sec>72C 30sec)*30
Buffer: 1x PCR buffer
Polymerase: 0.005U/microL Taq DNA poly (Perkin-Elmer Cetus)Cycler:
Note:

Total 2 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.