A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(IRES2) primer
Oligo ID:pj00070
Oligo type: Denegeracy: 1
Target: 298-318 Tm: 74.4 C at salt 1000.0mMLength: 21
Sequence: CCTGGTCTTTCCAGGTCTAGA
(0 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0325 Publication date: 12/00
PMID: 11101603 GI: 61076 Taxonomy ID:73481
Virus Name: Foot-and-mouth disease virus (strain A22/550 AZERBAIJAN 65); foot-and-mouth disease virus C1; Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3; Foot-and-mouth disease virus Asia 1; Foot-and-mouth disease virus (strain O1) Product size (PCR):
bp
MgCl2: 5.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):(95C 15sec>60C 60sec)*40
Buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl
Polymerase: 0.025U/microL Amplitaq Gold DNA poly (PE Applied Biosystems)Cycler:
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.