A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(P2) primer
Oligo ID:PE00008
Oligo type: Denegeracy: 1
Target: 2250-2222 Tm: 77.8 C at salt 1000.0mMLength: 29
Sequence: CTTACACAGACATATTTGCCTAGGTTCCA
(3 other experimental conditions)
Note: Mismatches at position 2234, 2237, 2246, 2247

Experimental condition used for the oligonucleotide

Common Data ID: JP0040 Publication date: 01/02
PMID: 11808702 GI: 323205 Taxonomy ID:121864
Virus Name: Bovine viral diarrhea virus-1, BVDV-1; Bovine viral diarrhea virus-2, BVDV-2 Product size (PCR): n/a bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-Semi-Nested PCR 1
Temp (PCR cycle):94C 2min>(94C 1min>55C 1min>72C 1min)*30>72C 10min.
Buffer: 1x PCR buffer
Polymerase: 0.05U/microL Taq polyCycler: PTC-100 thermal cycler (MJ research, Waltham MA, USA
Note: Mismatches at position 2234, 2237, 2246, 2247



Oligonucleotide information
Reverse(P2) primer
Oligo ID:PE00008
Oligo type: Denegeracy: 1
Target: 2250-2222 Tm: 77.8 C at salt 1000.0mMLength: 29
Sequence: CTTACACAGACATATTTGCCTAGGTTCCA
(3 other experimental conditions)
Note: Mismatches at position 2234, 2237, 2246, 2247

Experimental condition used for the oligonucleotide

Common Data ID: JP0041 Publication date: 01/02
PMID: 11808702 GI: 902376 Taxonomy ID:136447
Virus Name: bovine viral diarrhea virus type 2, BVDV 2 Product size (PCR): N/A bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-Semi-Nested PCR 2
Temp (PCR cycle):94C 2min>(94C 1min>50C 1min>72C 1min)*30>72C 10min
Buffer: 1x PCR buffer
Polymerase: 0.05U/microL Taq polyCycler: PTC-100 thermal cycler(MJ research, Waltham MA, USA)
Note: Mismatches at position 2234, 2237, 2246, 2247



Oligonucleotide information
Reverse(P2) primer
Oligo ID:PE00008
Oligo type: Denegeracy: 1
Target: 2250-2222 Tm: 77.8 C at salt 1000.0mMLength: 29
Sequence: CTTACACAGACATATTTGCCTAGGTTCCA
(3 other experimental conditions)
Note: Mismatches at position 2234, 2237, 2246, 2247

Experimental condition used for the oligonucleotide

Common Data ID: JP0040 Publication date: 01/02
PMID: 11808702 GI: 323205 Taxonomy ID:121864
Virus Name: Bovine viral diarrhea virus-1, BVDV-1; Bovine viral diarrhea virus-2, BVDV-2 Product size (PCR): n/a bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-Semi-Nested PCR 1
Temp (PCR cycle):94C 2min>(94C 1min>55C 1min>72C 1min)*30>72C 10min.
Buffer: 1x PCR buffer
Polymerase: 0.05U/microL Taq polyCycler: PTC-100 thermal cycler (MJ research, Waltham MA, USA
Note: Mismatches at position 2234, 2237, 2246, 2247



Oligonucleotide information
Reverse(P2) primer
Oligo ID:PE00008
Oligo type: Denegeracy: 1
Target: 2250-2222 Tm: 77.8 C at salt 1000.0mMLength: 29
Sequence: CTTACACAGACATATTTGCCTAGGTTCCA
(3 other experimental conditions)
Note: Mismatches at position 2234, 2237, 2246, 2247

Experimental condition used for the oligonucleotide

Common Data ID: JP0041 Publication date: 01/02
PMID: 11808702 GI: 902376 Taxonomy ID:136447
Virus Name: bovine viral diarrhea virus type 2, BVDV 2 Product size (PCR): N/A bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-Semi-Nested PCR 2
Temp (PCR cycle):94C 2min>(94C 1min>50C 1min>72C 1min)*30>72C 10min
Buffer: 1x PCR buffer
Polymerase: 0.05U/microL Taq polyCycler: PTC-100 thermal cycler(MJ research, Waltham MA, USA)
Note: Mismatches at position 2234, 2237, 2246, 2247

Total 4 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.