A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(P1) primer
Oligo ID:PE00007
Oligo type: Denegeracy: 1
Target: 1424-1448 Tm: 75.5 C at salt 1000.0mMLength: 25
Sequence: AACAAACATGGTTGGTGCAACTGGT
(1 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: JP0040 Publication date: 01/02
PMID: 11808702 GI: 323205 Taxonomy ID:121864
Virus Name: Bovine viral diarrhea virus-1, BVDV-1; Bovine viral diarrhea virus-2, BVDV-2 Product size (PCR): n/a bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-Semi-Nested PCR 1
Temp (PCR cycle):94C 2min>(94C 1min>55C 1min>72C 1min)*30>72C 10min.
Buffer: 1x PCR buffer
Polymerase: 0.05U/microL Taq polyCycler: PTC-100 thermal cycler (MJ research, Waltham MA, USA
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.