A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(4110) primer
Oligo ID:PE00006
Oligo type: Denegeracy: 1
Target: 2837-2810 Tm: 82 C at salt 1000.0mMLength: 28
Sequence: TCGCTGATGTTGTTCGGAGGGAGGTTGA
(0 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: JP0039 Publication date: 01/02
PMID: 11808702 GI: 330752 Taxonomy ID:10295
Virus Name: Bovine herpesvirus 2 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: PCR
Temp (PCR cycle):94C 3min>(94C 1min>68C 1min>72C 1min)*40>72C 10min
Buffer: 1x PCR Buffer, 2% DMSO
Polymerase: 0.05U/microL Taq DNA polyCycler: PTC-100 thermal cycler (MJ Research, Waltham MA, USA)
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.