A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(PD00520) primer
Oligo ID:PD00520
Oligo type: Denegeracy: 1
Target: 3888-3869 Tm: 78.2 C at salt 1000.0mMLength: 20
Sequence: GAAGGGCCCAGGGTTGGATC
(0 other experimental conditions)
Note: Mismatch at positions 3869 and 3870

Experimental condition used for the oligonucleotide

Common Data ID: MP0424 Publication date: 1986
PMID: 3034729 GI: 10445391 Taxonomy ID:12121
Virus Name: foot-and-mouth disease virus C1, FMDV Product size (PCR): N/A bp
MgCl2: 10 mM dNTPs: 0.25 mM Type: cDNA synthesis
Temp (PCR cycle):42C 1hr
Buffer: 2mM methylmercury hydroxide, 50mM Tris-HCl pH 8.3, 50mM KCl, 0.4mM DTT
Polymerase: N/ACycler: N/A
Note: Mismatch at positions 3869 and 3870

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.