A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(P3) primer
Oligo ID:pd00501
Oligo type: Denegeracy: 1
Target: 13302-13325 Tm: 67.9 C at salt 1000.0mMLength: 23
Sequence: ATAAATTTGTGAGACAATGGGTA
(0 other experimental conditions)
Note: There was a mismatch at position 13323. Primer is missing an A at position 13313.

Experimental condition used for the oligonucleotide

Common Data ID: JX0072 Publication date: 11/01
PMID: 11724141 GI: 13095578 Taxonomy ID:10385
Virus Name: Bovine herpesvirus 4 Product size (PCR): 130 bp
MgCl2: 3 mM dNTPs: 0.2 mM Type: Semi-nested PCR 2
Temp (PCR cycle):94C 1min>(94C 1min>58C 2min>72C 3min)*35
Buffer: 10mM Tris pH 8.3, 50mM KCl
Polymerase: 0.02U/microL Taq polyCycler: N/A
Note: There was a mismatch at position 13323. Primer is missing an A at position 13313.

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.