A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(PD00472) primer
Oligo ID:pd00472
Oligo type: Denegeracy: 1
Target: 3592-3572 Tm: 74.4 C at salt 1000.0mMLength: 21
Sequence: ACGTCGGAGAAAAAGAAGGGC
(0 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: JX0075 Publication date: 1998
PMID: 9608664 GI: 61076 Taxonomy ID:12111
Virus Name: Foot-and-mouth disease virus A, FMDV type A; Foot-and-mouth disease virus O, FMDV type O; Foot-and-mouth disease virus Asia 1, FMDV type Asia 1 Product size (PCR):
bp
MgCl2: N/A mM dNTPs: N/A mM Type: Universal PCR
Temp (PCR cycle):(92C 30sec>60C 30sec>75C 90sec)*30>75C 5min
Buffer: N/A
Polymerase: 0.025U/microL Taq polyCycler: PTC-100 (MJ Research, Inc.)
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.