A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(Oligo 7) primer
Oligo ID:pd00422
Oligo type: Denegeracy: 1
Target: 7676-7656 Tm: 70.5 C at salt 1000.0mMLength: 21
Sequence: GTAAAGTGATCTGTAGCTTGG
(0 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0484 Publication date: 03/92
PMID: 1313822 GI: 61076 Taxonomy ID:73482
Virus Name: Foot-and-mouth disease virus (strain O1); Foot-and-mouth disease virus (strain A12) Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs:
mM
Type: RT-PCR
Temp (PCR cycle):(93C 30sec>55C 30sec>72C 60sec)*35>72C 9min
Buffer: 10mM Tris-HCl (pH 8.3) 50mM KCl
Polymerase: 0.08U/microL Taq DNA poly (IBI)Cycler: programmable thermal controller (MJ Research Inc.)
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.