A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(Oligo 1) primer
Oligo ID:pd00419
Oligo type: Denegeracy: 1
Target: 3196-3215 Tm: 70 C at salt 1000.0mMLength: 20
Sequence: CAACTGCTTACCACAAAAGG
(0 other experimental conditions)
Note: Multiple mismatches.

Experimental condition used for the oligonucleotide

Common Data ID: BM0482 Publication date: 03/92
PMID: 1313822 GI: 61076 Taxonomy ID:73482
Virus Name: Foot-and-mouth disease virus (strain O1) Product size (PCR):
bp
MgCl2:
mM
dNTPs: 0.1 mM Type: RT-PCR
Temp (PCR cycle):(93C 30sec>55C 30sec>72C 60sec)*35>72C 9min
Buffer: 40mM KCl
Polymerase: 0.08U/microL Taq DNA poly (IBI)Cycler: HYBAID thermal reactor
Note: Multiple mismatches.

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.