A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(PD00387) primer
Oligo ID:pd00387
Oligo type: Denegeracy: 1
Target: 4406-4429 Tm: 77 C at salt 1000.0mMLength: 24
Sequence: ACAGGCAATTTCCACCCACTTCAC
(0 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: JX0067 Publication date: 01/00
PMID: 10644091 GI: 61076 Taxonomy ID:12118
Virus Name: Foot-and-mouth disease virus O Product size (PCR):
bp
MgCl2: 4.6 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):(95C 40sec>55C 30sec>72C 30sec)*31>72C 3min
Buffer: 18mM Tris-HCl (pH 8.3), 23mM KCl
Polymerase: 0.5microL Stoffel fragment of Taq poly (Perkin-Elmer)Cycler: Perkin-Elmer 9600
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.