A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(PD00256) primer
Oligo ID:pd00256
Oligo type: Denegeracy: 1
Target: 196-176 Tm: 76.4 C at salt 1000.0mMLength: 21
Sequence: GACGACTACCCTGTACTCAGG
(0 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0471 Publication date: 10/01
PMID: 11524161 GI: 323205 Taxonomy ID:11100
Virus Name: bovine viral diarrhea virus (isolate NADL); bovine viral diarrhea virus strain Oregon C24V; pestivirus type 1 (isolate 890) Product size (PCR):
bp
MgCl2: 4.0 mM dNTPs: 0.2 mM Type: Real Time RT-PCR
Temp (PCR cycle):48C 30min>95C 10min>(95C 15sec>60C 60sec)*45
Buffer: TaqMan universal 1x buffer
Polymerase: 0.025U/microL AmpliTaq Gold DNA polyCycler:
Note:



Oligonucleotide information
Reverse(PD00256) primer
Oligo ID:pd00256
Oligo type: Denegeracy: 1
Target: 196-176 Tm: 76.4 C at salt 1000.0mMLength: 21
Sequence: GACGACTACCCTGTACTCAGG
(0 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0471 Publication date: 10/01
PMID: 11524161 GI: 323205 Taxonomy ID:11100
Virus Name: bovine viral diarrhea virus (isolate NADL); bovine viral diarrhea virus strain Oregon C24V; pestivirus type 1 (isolate 890) Product size (PCR):
bp
MgCl2: 4.0 mM dNTPs: 0.2 mM Type: Real Time RT-PCR
Temp (PCR cycle):48C 30min>95C 10min>(95C 15sec>60C 60sec)*45
Buffer: TaqMan universal 1x buffer
Polymerase: 0.025U/microL AmpliTaq Gold DNA polyCycler:
Note:

Total 2 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.