A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(P1) primer
Oligo ID:PD00212
Oligo type: Denegeracy: 1
Target: 3578-3558 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST

Experimental condition used for the oligonucleotide

Common Data ID: MP0392 Publication date: 08/97
PMID: 9274816 GI: 3367676 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1 Product size (PCR): 246 bp
MgCl2: 1.5 mM dNTPs: 0.5 mM Type: RT-Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note: Target found in article (3649-3670) is different from target found in BLAST



Oligonucleotide information
Reverse(P1) primer
Oligo ID:PD00212
Oligo type: Denegeracy: 1
Target: 3578-3558 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST

Experimental condition used for the oligonucleotide

Common Data ID: MP0393 Publication date: 08/97
PMID: 9274816 GI: 6572136 Taxonomy ID:35292
Virus Name: Foot-and-mouth disease virus SAT 2 Product size (PCR): 75 bp
MgCl2: 1.5 mM dNTPs: 0.5 mM Type: RT-Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note: Target found in article (3649-3670) is different from target found in BLAST



Oligonucleotide information
Reverse(P1) primer
Oligo ID:PD00212
Oligo type: Denegeracy: 1
Target: 3578-3558 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST

Experimental condition used for the oligonucleotide

Common Data ID: MP0394 Publication date: 08/97
PMID: 9274816 GI: 576561 Taxonomy ID:12123
Virus Name: Foot-and-mouth disease virus SAT 3 Product size (PCR): 301 bp
MgCl2: 1.5 mM dNTPs: 0.5 mM Type: RT-Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note: Target found in article (3649-3670) is different from target found in BLAST



Oligonucleotide information
Reverse(P1) primer
Oligo ID:PD00212
Oligo type: Denegeracy: 1
Target: 3578-3558 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST

Experimental condition used for the oligonucleotide

Common Data ID: MP0392 Publication date: 08/97
PMID: 9274816 GI: 3367676 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1 Product size (PCR): 246 bp
MgCl2: 1.5 mM dNTPs: 0.5 mM Type: RT-Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note: Target found in article (3649-3670) is different from target found in BLAST



Oligonucleotide information
Reverse(P1) primer
Oligo ID:PD00212
Oligo type: Denegeracy: 1
Target: 3578-3558 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST

Experimental condition used for the oligonucleotide

Common Data ID: MP0393 Publication date: 08/97
PMID: 9274816 GI: 6572136 Taxonomy ID:35292
Virus Name: Foot-and-mouth disease virus SAT 2 Product size (PCR): 75 bp
MgCl2: 1.5 mM dNTPs: 0.5 mM Type: RT-Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note: Target found in article (3649-3670) is different from target found in BLAST



Oligonucleotide information
Reverse(P1) primer
Oligo ID:PD00212
Oligo type: Denegeracy: 1
Target: 3578-3558 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST

Experimental condition used for the oligonucleotide

Common Data ID: MP0394 Publication date: 08/97
PMID: 9274816 GI: 576561 Taxonomy ID:12123
Virus Name: Foot-and-mouth disease virus SAT 3 Product size (PCR): 301 bp
MgCl2: 1.5 mM dNTPs: 0.5 mM Type: RT-Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note: Target found in article (3649-3670) is different from target found in BLAST



Oligonucleotide information
Reverse(P1) primer
Oligo ID:PD00212
Oligo type: Denegeracy: 1
Target: 3578-3558 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST

Experimental condition used for the oligonucleotide

Common Data ID: MP0392 Publication date: 08/97
PMID: 9274816 GI: 3367676 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1 Product size (PCR): 246 bp
MgCl2: 1.5 mM dNTPs: 0.5 mM Type: RT-Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note: Target found in article (3649-3670) is different from target found in BLAST



Oligonucleotide information
Reverse(P1) primer
Oligo ID:PD00212
Oligo type: Denegeracy: 1
Target: 3578-3558 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST

Experimental condition used for the oligonucleotide

Common Data ID: MP0393 Publication date: 08/97
PMID: 9274816 GI: 6572136 Taxonomy ID:35292
Virus Name: Foot-and-mouth disease virus SAT 2 Product size (PCR): 75 bp
MgCl2: 1.5 mM dNTPs: 0.5 mM Type: RT-Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note: Target found in article (3649-3670) is different from target found in BLAST



Oligonucleotide information
Reverse(P1) primer
Oligo ID:PD00212
Oligo type: Denegeracy: 1
Target: 3578-3558 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST

Experimental condition used for the oligonucleotide

Common Data ID: MP0394 Publication date: 08/97
PMID: 9274816 GI: 576561 Taxonomy ID:12123
Virus Name: Foot-and-mouth disease virus SAT 3 Product size (PCR): 301 bp
MgCl2: 1.5 mM dNTPs: 0.5 mM Type: RT-Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note: Target found in article (3649-3670) is different from target found in BLAST

Total 9 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.