A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(3C2) primer
Oligo ID:pd00189
Oligo type: Denegeracy: 1
Target: 6205-6186 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: GAGTGAGTGCCGACGATGAA
(0 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0499 Publication date: 06/99
PMID: 10403677 GI: 61076 Taxonomy ID:12118
Virus Name: Foot-and-mouth disease virus O; Foot-and-mouth disease virus (strain A24 Cruzeiro); Foot-and-mouth disease virus C; Foot-and-mouth disease virus Asia 1; Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 1.0 mM Type: RT-nested PCR 2
Temp (PCR cycle):94C 60sec>(92C 30sec>60C 30sec>75C 90sec)*30>75C 5min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.02U/microL Taq polyCycler: Trio-Thermoblock (Biometra)
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.