A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(FMDV-2AR) primer
Oligo ID:PC00017
Oligo type: Denegeracy: 1
Target: 3934-3909 Tm: 80.5 C at salt 1000.0mMLength: 26
Sequence: TCGGAGAAAAAGAAGGGCCCAGGGTT
(0 other experimental conditions)
Note: Mismatches at 3914 and 3926

Experimental condition used for the oligonucleotide

Common Data ID: JP0024 Publication date: 02/01
PMID: 11222004 GI: 12018088 Taxonomy ID:12116
Virus Name: Foot-and-mouth disease virus C Product size (PCR): N/A bp
MgCl2: N/A mM dNTPs: N/A mM Type: Hybridization
Temp (PCR cycle):42C Overnight
Buffer: In Situ Hyb Buffer(Ambion, Abingdon, UK)
Polymerase:
Cycler:
Note: Mismatches at 3914 and 3926

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.