A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(P4) primer
Oligo ID:PB01461
Oligo type: Denegeracy: 1
Target: 3946-3926 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0734 Publication date: 07/02
PMID: 12088821 GI: 18074008 Taxonomy ID:110195
Virus Name: Foot-and-mouth disease virus Asia 1, FMDV Product size (PCR):
bp
MgCl2: N/A mM dNTPs: N/A mM Type: RT-PCR
Temp (PCR cycle):(93C 30sec>55C 120sec>72C 300sec)*40>72C 10min
Buffer: N/A
Polymerase: N/ACycler: N/A
Note:



Oligonucleotide information
Reverse(P4) primer
Oligo ID:PB01461
Oligo type: Denegeracy: 1
Target: 3946-3926 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0735 Publication date: 07/02
PMID: 12088821 GI: 18074008 Taxonomy ID:110195
Virus Name: Foot-and-mouth disease virus Asia 1, FMDV Product size (PCR):
bp
MgCl2: N/A mM dNTPs: N/A mM Type: RT-PCR
Temp (PCR cycle):(93C 30sec>55C 120sec>72C 300sec)*40>72C 10min
Buffer: N/A
Polymerase: N/ACycler: N/A
Note:



Oligonucleotide information
Reverse(P4) primer
Oligo ID:PB01461
Oligo type: Denegeracy: 1
Target: 3946-3926 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0734 Publication date: 07/02
PMID: 12088821 GI: 18074008 Taxonomy ID:110195
Virus Name: Foot-and-mouth disease virus Asia 1, FMDV Product size (PCR):
bp
MgCl2: N/A mM dNTPs: N/A mM Type: RT-PCR
Temp (PCR cycle):(93C 30sec>55C 120sec>72C 300sec)*40>72C 10min
Buffer: N/A
Polymerase: N/ACycler: N/A
Note:



Oligonucleotide information
Reverse(P4) primer
Oligo ID:PB01461
Oligo type: Denegeracy: 1
Target: 3946-3926 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0735 Publication date: 07/02
PMID: 12088821 GI: 18074008 Taxonomy ID:110195
Virus Name: Foot-and-mouth disease virus Asia 1, FMDV Product size (PCR):
bp
MgCl2: N/A mM dNTPs: N/A mM Type: RT-PCR
Temp (PCR cycle):(93C 30sec>55C 120sec>72C 300sec)*40>72C 10min
Buffer: N/A
Polymerase: N/ACycler: N/A
Note:



Oligonucleotide information
Reverse(P4) primer
Oligo ID:PB01461
Oligo type: Denegeracy: 1
Target: 3946-3926 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0734 Publication date: 07/02
PMID: 12088821 GI: 18074008 Taxonomy ID:110195
Virus Name: Foot-and-mouth disease virus Asia 1, FMDV Product size (PCR):
bp
MgCl2: N/A mM dNTPs: N/A mM Type: RT-PCR
Temp (PCR cycle):(93C 30sec>55C 120sec>72C 300sec)*40>72C 10min
Buffer: N/A
Polymerase: N/ACycler: N/A
Note:



Oligonucleotide information
Reverse(P4) primer
Oligo ID:PB01461
Oligo type: Denegeracy: 1
Target: 3946-3926 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0735 Publication date: 07/02
PMID: 12088821 GI: 18074008 Taxonomy ID:110195
Virus Name: Foot-and-mouth disease virus Asia 1, FMDV Product size (PCR):
bp
MgCl2: N/A mM dNTPs: N/A mM Type: RT-PCR
Temp (PCR cycle):(93C 30sec>55C 120sec>72C 300sec)*40>72C 10min
Buffer: N/A
Polymerase: N/ACycler: N/A
Note:



Oligonucleotide information
Reverse(P4) primer
Oligo ID:PB01461
Oligo type: Denegeracy: 1
Target: 3946-3926 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0734 Publication date: 07/02
PMID: 12088821 GI: 18074008 Taxonomy ID:110195
Virus Name: Foot-and-mouth disease virus Asia 1, FMDV Product size (PCR):
bp
MgCl2: N/A mM dNTPs: N/A mM Type: RT-PCR
Temp (PCR cycle):(93C 30sec>55C 120sec>72C 300sec)*40>72C 10min
Buffer: N/A
Polymerase: N/ACycler: N/A
Note:



Oligonucleotide information
Reverse(P4) primer
Oligo ID:PB01461
Oligo type: Denegeracy: 1
Target: 3946-3926 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0735 Publication date: 07/02
PMID: 12088821 GI: 18074008 Taxonomy ID:110195
Virus Name: Foot-and-mouth disease virus Asia 1, FMDV Product size (PCR):
bp
MgCl2: N/A mM dNTPs: N/A mM Type: RT-PCR
Temp (PCR cycle):(93C 30sec>55C 120sec>72C 300sec)*40>72C 10min
Buffer: N/A
Polymerase: N/ACycler: N/A
Note:

Total 8 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.