A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(P90) primer
Oligo ID:pb00509
Oligo type: Denegeracy: 1
Target: 3124-3147 Tm: 77 C at salt 1000.0mMLength: 24
Sequence: GTCATTGACCTCATGCAGACTCAC
(1 other experimental conditions)
Note: Specific to 1D region.

Experimental condition used for the oligonucleotide

Common Data ID: BM0286 Publication date: 1996
PMID: 8634024 GI: 61076 Taxonomy ID:12115
Virus Name: Foot-and-mouth disease virus (strain A24 Cruzeiro); foot-and-mouth disease virus C3, Resende; Foot-and-mouth disease virus (strain O1), BFS 1967; Foot-and-mouth disease virus Asia 1, Ind 9/89; Foot-and-mouth disease virus SAT 2, Knp 5/91/2 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.05 mM Type: Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Taq poly (Promega)Cycler: GeneAmp CR System 9600 (Perkin Elmer)
Note: Specific to 1D region.



Oligonucleotide information
Forward(P90) primer
Oligo ID:pb00509
Oligo type: Denegeracy: 1
Target: 3124-3147 Tm: 77 C at salt 1000.0mMLength: 24
Sequence: GTCATTGACCTCATGCAGACTCAC
(1 other experimental conditions)
Note: Specific to 1D region.

Experimental condition used for the oligonucleotide

Common Data ID: MP0307 Publication date: 12/99
PMID: 10598089 GI: 61076 Taxonomy ID:12118
Virus Name: Foot-and-mouth disease virus O, FMDV O; Foot-and-mouth disease virus A, FMDV A; Foot-and-mouth disease virus C, FMDV C; Foot-and-mouth disease virus Asia 1, FMDV Asia 1 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>58C 1min>72C 2min)*20>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Specific to 1D region.



Oligonucleotide information
Forward(P90) primer
Oligo ID:pb00509
Oligo type: Denegeracy: 1
Target: 3124-3147 Tm: 77 C at salt 1000.0mMLength: 24
Sequence: GTCATTGACCTCATGCAGACTCAC
(1 other experimental conditions)
Note: Specific to 1D region.

Experimental condition used for the oligonucleotide

Common Data ID: BM0286 Publication date: 1996
PMID: 8634024 GI: 61076 Taxonomy ID:12115
Virus Name: Foot-and-mouth disease virus (strain A24 Cruzeiro); foot-and-mouth disease virus C3, Resende; Foot-and-mouth disease virus (strain O1), BFS 1967; Foot-and-mouth disease virus Asia 1, Ind 9/89; Foot-and-mouth disease virus SAT 2, Knp 5/91/2 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.05 mM Type: Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Taq poly (Promega)Cycler: GeneAmp CR System 9600 (Perkin Elmer)
Note: Specific to 1D region.



Oligonucleotide information
Forward(P90) primer
Oligo ID:pb00509
Oligo type: Denegeracy: 1
Target: 3124-3147 Tm: 77 C at salt 1000.0mMLength: 24
Sequence: GTCATTGACCTCATGCAGACTCAC
(1 other experimental conditions)
Note: Specific to 1D region.

Experimental condition used for the oligonucleotide

Common Data ID: MP0307 Publication date: 12/99
PMID: 10598089 GI: 61076 Taxonomy ID:12118
Virus Name: Foot-and-mouth disease virus O, FMDV O; Foot-and-mouth disease virus A, FMDV A; Foot-and-mouth disease virus C, FMDV C; Foot-and-mouth disease virus Asia 1, FMDV Asia 1 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>58C 1min>72C 2min)*20>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Specific to 1D region.

Total 4 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.