A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(OPES 12a) primer
Oligo ID:pb00447
Oligo type: Denegeracy: 1
Target: 346-325 Tm: 78.5 C at salt 1000.0mMLength: 22
Sequence: GGCCTTTGCAGCACCCTATCAG
(0 other experimental conditions)
Note: Mismatch at BLAST position 341.

Experimental condition used for the oligonucleotide

Common Data ID: MP0153 Publication date: 02/98
PMID: 9787488 GI: 9626649 Taxonomy ID:144353
Virus Name: Bovine viral diarrhea virus, BVDV Product size (PCR): 169 bp
MgCl2: 2.5 mM dNTPs: 0.1 mM Type: RT-Nested PCR 2
Temp (PCR cycle):(94C 45sec>55C 30sec>72C 60sec)*5>(94C 45sec>50C 60sec>72C 180sec)*30>72C 7min
Buffer: 10mM Tris-HCl, pH 9.0, 50mM KCl and 100microg/mL BSA
Polymerase: 0.02U/microL Taq poly (Perkin-Elmer Cetus)Cycler: DNA Thermal Cycler (Perkin-Elmer Cetus)
Note: Mismatch at BLAST position 341.

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.