A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(OPES 13a) primer
Oligo ID:pb00444
Oligo type: Denegeracy: 1
Target: 101-122 Tm: 76.6 C at salt 1000.0mMLength: 22
Sequence: GCTAGCCATGCCCTTAGTAGGA
(0 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0152 Publication date: 02/98
PMID: 9787488 GI: 9626649 Taxonomy ID:144353
Virus Name: Bovine viral diarrhea virus, BVDV Product size (PCR): 296 bp
MgCl2: 2.5 mM dNTPs: 0.11 mM Type: RT-Nested PCR 1
Temp (PCR cycle):(94C 45sec>50C 30sec>72C 60sec)*5>(94C 45sec>45C 60sec>72C 180sec)*30>72C 7min
Buffer: 10mM Tris-HCl, pH 9.0, 50mMKCl and 0.1mg/mL BSA
Polymerase: 0.02U/microL Taq poly (Perkin-Elmer Cetus, Norwalk, Ct, USA)Cycler: DNA Thermal Cycler (Perkin-Elmer Cetus)
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.