A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(7451) primer
Oligo ID:pb00443
Oligo type: Denegeracy: 1
Target: 7474-7451 Tm: 80.4 C at salt 1000.0mMLength: 24
Sequence: GGACAACCCGGTCACTTGCTTCAG
(2 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0055 Publication date: 1991
PMID: 9210942 GI: 9626649 Taxonomy ID:11100
Virus Name: bovine viral diarrhea virus (isolate NADL), NADL BVDV Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 2min>(94C 1min>55C 1.5min>72C 3min)*30>72C 7min
Buffer: 1x PCR buffer (GeneAmp; Perkin-Elmer Cetus Corp.)
Polymerase: 0.025U/microL Amplitaq poly (Perkin-Elmer Cetus Corp.)Cycler: DNA thermal cycler (Coy Laboratory Products, Inc.)
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.