A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(PB00441) primer
Oligo ID:pb00441
Oligo type: Denegeracy: 1
Target: 123498-123475 Tm: 83.8 C at salt 1000.0mMLength: 24
Sequence: CAGCCCTACACGCGGGTGCTTTCC
(0 other experimental conditions)
Note: Specific to gE gene.

Experimental condition used for the oligonucleotide

Common Data ID: BM0057 Publication date: 09/00
PMID: 11014611 GI: 2653291 Taxonomy ID:10320
Virus Name: Bovine herpesvirus 1 Salwa isolate, BHV-1 Product size (PCR):
bp
MgCl2: 2.0 mM dNTPs: 0.1 mM Type: PCR
Temp (PCR cycle):94C 9min>(95C 1min>65C 1min>72C 2.5min)*35>72C 7min
Buffer: 1x PCR buffer (Perkin-Elmer Cetus)
Polymerase: 0.02U/microL AmpliTaq Gold DNA poly (Perkin-Elmer)Cycler:
Note: Specific to gE gene.

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.