A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(PB00404) primer
Oligo ID:pb00404
Oligo type: Denegeracy: 1
Target: 858-899 Tm: 88.7 C at salt 1000.0mMLength: 42
Sequence: GGCGTCATTTACAAGGAGAACATCGCGCCGTACACGTTCAAG
(0 other experimental conditions)
Note: Specific to the glycoprotein gI gene.

Experimental condition used for the oligonucleotide

Common Data ID: BM0037 Publication date: 1993
PMID: 8116497 GI: 330756 Taxonomy ID:10320
Virus Name: Bovine herpesvirus 1, BHV-1 Product size (PCR):
bp
MgCl2:
mM
dNTPs:
mM
Type: Dot-blot Hybridization
Temp (PCR cycle):58C 18hrs
Buffer: 6x SSC, 0.5% SDS, 5x Denhart solution, and 100microg/mL denatured salmon sperm DNA
Polymerase:
Cycler:
Note: Specific to the glycoprotein gI gene.

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.