A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(BD1) primer
Oligo ID:pb00366
Oligo type: Denegeracy: 1
Target: 367-387 Tm: 72.5 C at salt 1000.0mMLength: 21
Sequence: TCTCTGCTGTACATGGCACAT
(0 other experimental conditions)
Note: Specific to p20 (Npro) and a part of the C coding region.

Experimental condition used for the oligonucleotide

Common Data ID: BM0051 Publication date: 04/97
PMID: 9129644 GI: 7960755 Taxonomy ID:61010
Virus Name: Border disease virus strain Moredun cp, BDV cp; Border disease virus strain Moredun ncp, BDV ncp; Hog cholera virus (strain Brescia), CSFV; bovine viral diarrhea virus (isolate NADL), BVDV NADL Product size (PCR):
bp
MgCl2: 2.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):(94C 1min>52C 1min>72C 1min)*35>72C 7min
Buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl, 0.1mg/mL BSA
Polymerase: 0.02U/microL Taq poly (Perkin Elmer-Cetus)Cycler: Perkin Elmer-Cetus thermocycler
Note: Specific to p20 (Npro) and a part of the C coding region.

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.